LEIA ANTES DE ACESSAR O CONTEÚDO | Esse espaço tem o objetivo de oferecer suporte didático democratizando o ensino da Biologia. Todo o conteúdo encontrado aqui (resumos, exercícios, textos etc.), poderá ser livremente baixado ou citado por professores, alunos, outros Blogs, sites, fóruns ou qualquer mídia de comunicação mediante informação da fonte: SILVA, F. R., Et al. . Eu Não Entendo Biologia. 2008; Tema: Biologia para o ensino médio. (Blog).Acessado em:__/__/2017.
NÃO RESOLVEMOS QUALQUER TIPO DE TRABALHO ESCOLAR OU UNIVERSITÁRIO.
Você que acessa e utiliza o site esteja ciente das informações acima aproveite e deixe um comentário.
Para se cadastrar como frequentador
CLIK AQUI

Pesquisar no Blog

Exercício de fixação - Síntese Protéica

01) Questão
Observe o esquema e abaixo e a tabela do código genético.
Esquema:
Tabela do código genético
Responda:
a) Qual a sequência de nucleotídeos no sentido 5' para 3' da cadeia 1 de DNA?
b) Qual a sequência de nucleotídeos no sentido 5' para 3' da cadeia 2 de RNA?
c) Como é chamado o processo 3 que ocorre a formação do RNAm?
d) Qual seria a sequencia de aminoácidos formada por esse gene? (Consulte a tabela do código genético) 
(Obs: Deixe suas respostas no espaço abaixo destinado aos comentários).


26 comentários:

  1. Escola:E.E.F.M Armando Fajardo
    Anonimo: Edemilson, Pedro, Jhonatan
    Serie 1º Ano A Turno:Tarde

    1)
    a)5' ATGGGGCCCTGCCATTAA 3'DNA
    b)5'AUGGGGCCCUGCCAUGGAUA 3'RNA
    c)Transcrição
    d)Met,Gly,Pro

    ResponderExcluir
    Respostas
    1. Olá Edemison, Pedro e Jhonatan na letra (d) a sequencia correta de aminoácidos é: MET,GLY,PRO,CYS,HIS,GLY. O resto tudo ok.

      Excluir
  2. Escola:Armando fajardo
    Aluno:Hilder Mauricio
    Aluno:Jean Lincon
    Turma:1ªA

    Respostas:
    ATIVIDADES
    1ª)
    A) ATG GGG CCC TGC CAT GGT TAA.

    B) AUG GGG CCC UGC CAU GGU UAA.

    C) TRANSCRIÇÃO.

    D) MET,GLY,PRO,CYS,HIS,GLY.

    ResponderExcluir
  3. ARMANDO FAJARDO
    alunos: Alessandro costa da luz.
    aluno: Adilson da silva de souza.
    aluno: Ricardo souza lima.
    aluno: Marcelo solza.
    --- Primeiro ano (A)
    a) ATG GGG CCC TGC CAT GGA TAA
    b) AUG GGG CCC UGC CAU GGA UAA
    c) È o processo de formação do RNAm a partir da cadeia- molde de DNA.
    d) (met)- (gly)- (pro)- (cys)- (his)- (gly).

    ResponderExcluir
  4. Alunas: Fernanda Aline, Laura Marcela, Marcela Rodrigues, Pamela Castro.
    Série: 1° ANO A-TARDE

    1ª a) TAC CCC GGG ACG GTA CCT ATT
    ATG GGG CCC TGC CAT GGA TAA

    b) TAC CCC GGG ACG GTA CCT ATT
    AUG GGG CCC UGC CAU GGU UAA
    Obs: Rna

    c) Transcrição

    d) MET- GLY- PRO- CYS- HIS- GLY- NADA

    ResponderExcluir

  5. SERIè: 1 ANO TARDE
    ATIVIDADE ]
    1)a)
    ATG
    GGG CCC TGC CAT GGT TAA
    B) AUG GGG CCC UGC CAU GGU UAA
    C) TRANSCRIÇÃO
    D) MET,GLY,PRO,CYS,HIS,GLY.

    ResponderExcluir
  6. FOI MUITO BOM ESSA AULA ENTENDI O SUFICIENTE, FOI BOM MESMO.....
    R:3 5
    A T
    T A
    C G
    G C
    C G
    T A
    2:5AUGGCU3
    R:
    ESCOLA:ARMANDO FAJARDO
    ALUNOS:ROGERIO MEIRELES
    EDUARDO AUGUSTO
    TURMA:1(A)

    ResponderExcluir
  7. escola: ARMANDO FAJARDO
    ALUNOS; LAUCIA COSTA
    ELIVELTON LIMA
    LUCAS BENTES
    SERIè: 1 ANO TARDE
    ATIVIDADE
    1-A) ATTG GGG CCC TGC CAT GGT TAA
    B) AUG GGG CCC UGC CAU GGU UAA
    C) TRANSCRIÇÃO
    D) MET, GLY, PRO, CYS, HIS, GLY

    ResponderExcluir
  8. escola:Armando Fajardo
    alunos:joyce Medeiros
    Mario Weslley
    Francisco Gean
    Elivelto silva
    serie:1º ano turma: A turno:tarde



    a) DNA = ATG GGG CCC TGC CAT GGA TAA

    b) RNA = UAC CCC GGG ACG GUA CCU UAA

    c) Transcrição

    d) met-gly-pro-cys-gly-pro

    ResponderExcluir
  9. Alunas: Bruna Martins,Thalia Modesto.
    a).ATG CCC TGC CAT GGA TAA.
    B).AUG GGG CCC UGC CAU UAA.
    C)Transcrição.
    D).AUG GGG CCC UGC CAU GGA UAG.

    ResponderExcluir
  10. Alunos:leticia andrade,iara rodriques,paulo andre joel santos.
    turma:1B
    1)a-5'ATG GGG CCC TGC CAT GGA TAA 3'
    b-5'AUG GGG CCC UGC CAU GGA UAA 3'
    c-TRANSCRICAO
    d-6
    d-AUG GGG CCC UGC CAU GGA UAA
    met gly pro cys his gly

    ResponderExcluir
  11. A)ATG GGG CCC TGC CAT GGA TAA
    B)AUG GGG CCC UGC CAU GGA UAA
    C)TRASCRIÇÃO
    D) 6
    D) AUG GGG CCC UGC CAU GGA UAA
    MET GLY PRO CYS HIS GLY

    ALUNAS: CAROL RODRIGUES, PAULA SANTOS, RAISSA LOBO, LARISSA VICTORIA
    TURMA: 1 ANO B TURNO: TARDE

    ResponderExcluir
  12. alunos: Daniel Sameque n:5 Turma: 1B
    Luanda Jhulie n:24
    Jhonata Alef n:15


    a) ATG GGG CCC TGC CAT GGA TAA
    b) AUG GGG CCC UGC CAU GGA UAA
    c) TRASCRIÇÃO
    D) AUG GGG CCC UGC CAU GGA UAA
    MET GLY PRO CYS HPS CLY

    ResponderExcluir
  13. Alumos: Laiana Silva Rodrigo Liberato

    (A) ATG GGG CCC TGL CAT GGA TAA
    (B) AVG GGG CCG VGG CAV GGA VAA
    (C) TRANSCRICÂO
    (D) 6
    (D) AVG GGG CCC VGC CAU GGA UAA
    MET GLY PRO CYS HIS GLY

    ResponderExcluir
  14. Alunas:Bruna Martins,Thalia Modesto.
    A).ATG CCC TGC CAT GGA TAA.
    B).AUG GGG CCC UGC CAU UAA.
    C)transcrição.
    D).AUG GGG CCC UGC CAU GGA UAG.

    ResponderExcluir
  15. Escola:Armando Fajardo
    Turma:1b
    Alunas:Jane Paula Santos.Jacilene Trindade.Franciny Freitas e Elem Santos.

    Aº)R=ATG,GGG,CCC,TGC,GGA,TAA,

    Bº)R=AUG,CGG,CCC,UGC,CAU,GAA,UAA

    Cº)R=TRANSCRIÇÃO

    Dº)R=6

    Dº)R=MET,GLY,PRO,CYS,GLY

    ResponderExcluir
  16. alunos:leonardo martins,tamires martins,lucas souza
    turma:1B
    1-A) 5'ATG GGG CCC TGC CAT GGA TAA 3'
    b)5'AUG GGG CCC UGC CAU GGA UAA 3'
    c)transcricao
    d)6
    d)AUG GGG CCC UGC CAU GGA UAA
    met gly pro cys his gly

    ResponderExcluir
  17. ALUNAS:LORENA SILVA, ROSIANE ALMEIDA,ANDREZA FERREIRA,FABIANE ARAUJO 1B
    RESPOSTAS
    1(a)ATG GGG CCC TGC CAT GGA TAA
    (b)AUG GGG CCC UGC CAU GGA UAA
    (C) TRASCRIÇÃO
    (d) 6
    (d) AUG GGG CCC UGC CAU GGA UAA
    MET GLY PRO CYS HIS CLY

    ResponderExcluir
  18. Armando fajardo T:1c
    alunos: Alex farias, Bruna de Cássia, Josilene Gonçalves, Elizabeth Cristina
    a)ATG GGG CCC TGC CAT GGA TAA
    B)AUG GGG CCC UGC CAU GGA UAA
    C)transcrição do codigo genetico
    d)06 rnat
    d) MET-GLY-PRO-CYS-HIS-GLY

    ResponderExcluir
  19. E.E.E.F.M Armando Fajardo
    1 Ano C - Tarde
    Alunos: Bruna Ferreira
    David Coelho
    Deivison Alex
    Israel Soares
    Data: 03/12/12

    Respostas:
    a)- 5' ATG GGG CCC TGC CAT GGA TAA 3'
    b)- 5' AUG GGG CCC UGC CAU GGA UAA 3'
    c)- Transcrição Do Código Genético
    d)- MET GLY PRO CYS HIS GLY

    ResponderExcluir
  20. E.E.F.M ARMANDO FAJARDO
    1°C - TARDE
    ALUNOS:ERICK LIMA
    HARLEY CARDOSO (PERTUBANDO A AULA)
    Data: 03/12/12
    respostas:
    1-ATG-GGG-CCC-TGC-CAT-GGA-TAA

    2-AUG-GGG-CCC-UGC-CAU-GGA-UAA

    3-TRANSCRIÇÃO DO CODIGO GENETICO

    4-6 MET-GLY-PRO-HIS-GLY

    ResponderExcluir
  21. Escola : Armando Fajardo
    equipe : Emanuelly França
    Hiandala Rosario Ferreira
    Maria Fabiane
    brenda cristina
    1 ano c tarde !!!

    A) ATG . GGG .CCC. TGC . CAT . GGA . TAA
    TAC . CCC .GGG . ACG .GTA . CCT . ATT

    B) AUG . CCC . VGC . CAV . GGA . VAA

    c) TRANSCRIÇÃO DO CODIGO GENETICO

    d) MET -- GLY -- CYS -- HIS -- GLY -- TYR

    ResponderExcluir
  22. E.E.E.F.M. ARMANDO FAJARDO
    1 ANO -C TARDE ALUNOS:LURDILENE ALVES ,LELICIA BRITO,LOURIS VANE SOUSA,JOSEMIR GONSALVIS

    01:A) 5-ATG GGG CCC TGC CAT GGA TAA-3

    B)5-AUG GGG CCC UGC CAU GGA UAA-3
    C) TRANSCRIÇAO DO CODIGO GENÉTICO
    D)SITE : MET-GLY-PRO-CYS-HIS-GLY
    D)SÃO 6 RESPONSAVEIS POR TRAZER O AMINOACIDO



    ResponderExcluir
  23. ESCOLA: ARMANDO FAJARDO
    ALUNOS(A):ALESSANDRA SILVA/ALEX VASCONCELOS /JOSIANE PINHEIRO/ ISABELY GONÇALVES 1º C TARDE
    A)ATG GGG CCC TGC CAT GGA TAA
    B)AUG GGG CCC UGC CAU GGA UAA
    C)TRANSGRIÇÃO DO CODIGO GENETICO
    D)6 RNAT
    MET-GLY-PRO-CYS-HIS-GLY

    ResponderExcluir

Atenção! Os comentários são para trocamos conteúdos, opiniões, dúvidas, elogios, críticas, sugestões etc., ou seja, é uma forma de interagirmos com você. Então deixe sua mensagem aqui abaixo, pois é nosso principal combustível para novas postagens.

QUESTÕES DE BIOLOGIA DE VESTIBULARES RECENTES CLIQUE AQUI PARA BAIXAR